What size is pEGFP N1?
Plasmid: pEGFP-N1
| Source/Vendor: | Clontech |
|---|---|
| Size: | 4700 |
| 5′ Sequencing 1 Primer: | CMV-F, EGFP-N |
| 5′ Sequencing 1 Primer Sequence: | 5’d[CGTCGCCGTCCAGCTCGACCAG]3′ |
| Tag 1: | EGFP (Cterm) |
What is pEGFP N1?
pEGFP-N1 encodes a red-shifted variant of wild-type GFP (1–3) which has been optimized for brighter fluorescence and higher expression in mammalian cells. (Excitation maximum = 488 nm; emission maximum = 507 nm.) The MCS in pEGFP-N1 is between the immediate early promoter of CMV (PCMV IE) and the EGFP coding sequences.
What is PCMV plasmid?
The pCMV-Script vector is derived from a high-copy-number pUC-based plasmid and is designed to allow protein expression in mammalian systems. Mammalian expression is driven by the human cytomegalovirus (CMV) immediate early promoter to promote constitutive expression of cloned inserts in a wide variety of cell lines.
What is pcdna3?
This pcDNA™3.1(+) vector is designed for high-level, constitutive expression in a variety of mammalian cell lines. It contains a Geneticin® selectable marker and a forward-orientation multiple cloning site.
What is F1 origin?
General description. A versatile cloning plasmid vector for the expression of genes in mammalian cells that can also be used to make single stranded DNA in bacterial cells that have been infected with bacteriophage F1. The F1 origin has been inserted into the PacI site and is now flanked by two PacI sites.
What is pUC origin?
The designation “pUC” is derived from the classical “p” prefix (denoting “plasmid”) and the abbreviation for the University of California, where early work on the plasmid series had been conducted. It is a circular double stranded DNA and has 2686 base pairs.
What is a high copy plasmid?
A high-copy plasmid should yield between 3-5 ug DNA per 1 ml LB culture, while a low-copy plasmid will yield between 0.2-1 ug DNA per ml of LB culture. Origins of replication and copy numbers of various plasmids and cosmids. DNA construct. Origin of Replication.
What is Dnastar lasergene?
DNASTAR Lasergene is the complete software solution you need for designing primers, performing multiple sequence alignments, assembling and analyzing NGS sequencing data, and more.
Who makes SnapGene?
GraphPad Software
SAN DIEGO, Aug. 13, 2019 /PRNewswire/ — GraphPad Software announced today it has acquired SnapGene, a leading bioinformatics software solution. SnapGene is the easiest way to plan, visualize, and document molecular biology procedures. It was developed by Benjamin Glick, Ph.
What kind of plasmid is pegfp-n1?
Plasmid classification: lactation serial plasmids; lactating fluorescent plasmid; lactation green plasmid pEGFP-N1 encodes a red-shifted variant of wild-type GFP which has been optimized for brighter fluorescence and higher expression in mammalian cells.
How is pegfp-n1 used to digest vector?
If you wish to digest the vector with this enzyme, you will need to transform the vector into a dam– and make fresh DNA. Description: pEGFP-N1 encodes a red-shifted variant of wild-type GFP (1–3) which has been optimized for brighter fluorescence and higher expression in mammalian cells.
What is the excitation maximum of pegfp-n1?
(Excitation maximum = 488 nm; emission maximum = 507 nm.) pEGFP-N1 encodes the GFPmut1 variant which contains the double-amino-acid substitution of Phe-64 to Leu and Ser-65 to Thr. The coding sequence of the EGFP gene contains more than 190 silent base changes which correspond to human codon-usage preferences.
What is the role of pegfp-n1 in E coli?
A bacterial promoter upstream of this cassette expresses kanamycin resistance in E. coli. The pEGFP-N1 backbone also provides a pUC origin of replication for propagation in E. coli and an f1 origin for single-stranded DNA production.